Logo-apb

Submitted: 25 May 2019
Revised: 04 Sep 2019
Accepted: 30 Sep 2019
First published online: 11 Dec 2019
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract View: 2764
PDF Download: 1786
Full Text View: 976
Advanced pharmaceutical bulletin. 10(1):97-105. doi: 10.15171/apb.2020.012

Research Article

Classification of Riboswitch Families Using Block Location-Based Feature Extraction (BLBFE) Method

Faegheh Golabi 1, 2 ORCID logo, Mousa Shamsi 1, * ORCID logo, Mohammad Hosein Sedaaghi 3 ORCID logo, Abolfazl Barzegar 2, 4 ORCID logo, Mohammad Saeid Hejazi 5, 6, * ORCID logo

Author information:
1Genomic Signal Processing Laboratory, Faculty of Biomedical Engineering, Sahand University of Technology, Tabriz, Iran.
2School of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran.
3Faculty of Electrical Engineering, Sahand University of Technology, Tabriz, Iran.
4Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Tabriz, Iran.
5Molecular Medicine Research Center, Biomedicine Institute, Tabriz University of Medical Sciences, Tabriz, Iran.
6Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran.

*Corresponding Author: Mousa Shamsi and Mohammad Saeid Hejazi, Email: shamsi@sut.ac.ir, Fax: +98 41 33344798 , Email: msaeidhejazi@yahoo.com

Abstract

Purpose: Riboswitches are special non-coding sequences usually located in mRNAs’ un-translated regions and regulate gene expression and consequently cellular function. Furthermore, their interaction with antibiotics has been recently implicated. This raises more interest in development of bioinformatics tools for riboswitch studies. Herein, we describe the development and employment of novel block location-based feature extraction (BLBFE) method for classification of riboswitches.

Methods: We have already developed and reported a sequential block finding (SBF) algorithm which, without operating alignment methods, identifies family specific sequential blocks for riboswitch families. Herein, we employed this algorithm for 7 riboswitch families including lysine, cobalamin, glycine, SAM-alpha, SAM-IV, cyclic-di-GMP-I and SAH. Then the study was extended toward implementation of BLBFE method for feature extraction. The outcome features were applied in various classifiers including linear discriminant analysis (LDA), probabilistic neural network (PNN), decision tree and k-nearest neighbors (KNN) classifiers for classification of the riboswitch families. The performance of the classifiers was investigated according to performance measures such as correct classification rate (CCR), accuracy, sensitivity, specificity and f-score.

Results: As a result, average CCR for classification of riboswitches was 87.87%. Furthermore, application of BLBFE method in 4 classifiers displayed average accuracies of 93.98% to 96.1%, average sensitivities of 76.76% to 83.61%, average specificities of 96.53% to 97.69% and average f-scores of 74.9% to 81.91%.

Conclusion: Our results approved that the proposed method of feature extraction; i.e. BLBFE method; can be successfully used for classification and discrimination of the riboswitch families with high CCR, accuracy, sensitivity, specificity and f-score values.

Keywords: Riboswitch, Non-coding RNA, Sequential blocks, Block location-based feature extraction, BLBFE, Classification, Performance measures

Copyright and License Information

© 2020 The Author (s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution (CC BY), which permits unrestricted use, distribution, and reproduction in any medium, as long as the original authors and source are cited. No permission is required from the authors or the publishers.

Introduction

Regulation of cellular functions are achieved by effective collaboration of varying types of bio-molecules such as DNAs, RNAs and proteins. Riboswitches 1-4 as an example of regulatory RNAs, are a part of mRNA molecules and regulate the expression of corresponding genes by directly binding to the target metabolites and undergoing consequent structural changes. 5-7 For instance, the riboswitch structural conformation alteration blocks the ribosome binding site and inhibits protein synthesis by the ribosome. Riboswitches are usually located in mRNAs’ 5’ un-translated regions. 3 Riboswitches with similar sequence and secondary and tertiary structures perform similar tasks. 8,9 Therefore, riboswitches are categorized to families according to their function, sequence conservation and structural similarities. 10,11

Studies showed that riboswitches interact with antibiotics and regulate the expression of the corresponding gene. The interaction of antibiotics with riboswitches could be attributed at least partly to the action mechanism of the antibacterial agents. 12 Sudarsan and colleagues 13 showed the interaction of pyrithiamine with thiamine pyrophosphate riboswitch. Interaction of lysine riboswitch with antibiotics was reported by Blount and co-workers 14 and interaction of roseoflavin antibiotic with FMN riboswitch was also confirmed. 15-17 Our in-silico studies indicated that aminoglycosides including kanamycin interact with various riboswitches and their binding energies are comparable or sometimes higher than those of their native target molecules. 18,19 Later, Baird and colleagues 20 during their study, unexpectedly and interestingly noticed that kanamycin binds to cyclic diguanylate (cyclic-di-GMP) riboswitch and inhibits its binding with native ligand. Their in-vitro findings were in accordance with our in-silico results. Riboswitches could be considered as new targets for antibiotics and their interaction with antibiotics could explain new mechanisms for antibiotics’ functions and effects and consequently opens a new era for development of novel antibiotics. Established important role of riboswitches in the nature and development of novel therapeutic agents attracts increased attention for elucidation of riboswitches’ characteristics and development of new tools for riboswitch detection is accordingly in demand.

Classification of riboswitches into their related families gives insight to their functionality and structural aspects. One of the common principles for classification of riboswitches relies on homology search. 21 Based on this principle, various statistical methods have been developed such as hidden Markov models based methods 22-25 and CM or covariance model. 26 Singh and Singh used mononucleotide and dinucleotide conservation based features to classify the riboswitches. 27 Pse-in-One web server also generates various modes of pseudo components of RNA sequences which can be used as feature vectors for classification of riboswitches. 28,29

A non-alignment sequential block finding algorithm (SBF) was designed for identification of family specific RNA sequential blocks in different riboswitch families. 30 In the present study, we applied the SBF to 7 families of riboswitches and extracted the family specific sequential blocks. Then, we developed BLBFE method as a novel feature extraction method based on the locations of the detected blocks. The extracted features were utilized for classification of the riboswitches. For this, linear discriminant analysis (LDA), 31 probabilistic neural network (PNN), 32 decision tree 33 and k-nearest neighbors (KNN) 34 classifiers accompanied by V-fold cross-validation 35 were applied for classification of sequences into their related classes (families) based on the features extracted by block location-based feature extraction (BLBFE) method. Then, the performance of each classifier was presented by a confusion matrix. In the next step, performance measures such as accuracy, sensitivity, specificity and f-score were calculated for each classifier to study the performance validity of the developed feature extraction method.


Materials and Methods

Datasets

Table 1 shows seven families of riboswitches, whose seed data were used for block detection and classification in this study. The riboswitch families include lysine, 36,37 cobalamin, 7,38-40 glycine, 41-43 SAM-alpha, 44,45 SAM-IV, 46,47 cyclic-di-GMP-I 46,48,49 and SAH 50,51 families, containing 47, 430, 44, 40, 40, 155 and 52 seed members in each family, respectively. Datasets along with their sequential and secondary structure characteristics were downloaded from Rfam 13.0 database in un-gapped FASTA format. 52,53 Table 1 also represents calculated mean lengths and variance of lengths of the members for the studied families.


Table 1. Seven riboswitch families obtained from Rfam 13.0 database
Riboswitch family name Rfamaccession number Number of seed data Average length of members (nucleotides) Variance of the length of members
Lysine RF00168 47 183 11.06
Cobalamin RF00174 430 203 15.54
Glycine RF00504 44 101 15.99
SAM-alpha RF00521 40 79 1.18
SAM-IV RF00634 40 116 4.13
Cyclic-di-GMP-I RF01051 155 87 6
SAH RF01057 52 85 15.4

Application of the block finding algorithm

We have previously designed a block finder program for detection of frequent RNA blocks in riboswitch families. 30 In this method, an algorithm was used to identify the frequently appearing specific sequential blocks in riboswitch families. These blocks are characteristic motifs of a certain riboswitch family which are present in a very high percentage of the riboswitch family members complying the sequence conservation of riboswitch families. Also in a high percentage of family members, location of the motifs on the sequences should be the same or in a close defined neighborhood. In this path, the algorithm first recognizes all potential blocks, then checks each block’s location on every member of the family and eliminates the excess blocks accordingly. Finally, for each riboswitch family a set of specific sequential blocks is determined.

Feature extraction

We employed the locations of family-specific blocks on riboswitch sequences as features for classification of the riboswitches. To extract the features, first, sequential conserved blocks for the seven riboswitch families were detected using our previously reported SBF method. The detected blocks were then employed to produce observations related to each riboswitch family member. For this, the start point of each block on the sequence was considered as the block’s location in the sequence. Then, the locations of the blocks in the sequences were used as features. For the blocks which were not present in the sequence, the location was set to zero. For example, to produce an observation based on the following 10 blocks [GGUUC, CCC, AAAAACUA, GUGC, UAUA, UCUACC, GGGC, GGAUG, GGG, CUGAGA] for a sample riboswitch sequence such as:

“CCGCAUUCUCAGGGCAGCGU GAAAUUCCCUACU GGCGGUCAAGCG CGCGAGCGUU UGUUAUAAGGCAAAU CAGCAGAUUUGGUGAAAU UCCAAAGCCAA CAGUUACA GUCUGGA UGAAAG AGAGUAAAC”

The location of each block on the sequence is determined. Since block “GGUUC” (the first block) is not present in the sequence, its location is set to zero. The block “CCC” (the second block) starts from the 27th nucleotide of the sequence, so its location is set to 27. “AAAAACUA” and “GUGC” blocks are also not present in the sequence and their locations are considered as zero. The “UAUA” block is seen at the 59th nucleotide. Similarly, “UCUACC”, “GGGC”, “GGAUG”, “GGG” and “CUGAGA” blocks are located at 0th, 12th, 113th, 12th and 0th nucleotides, respectively. By finding the location of the all blocks, the observation associated with the above mentioned sequence is [0, 27, 0, 0, 59, 0, 12, 113, 12, 0] which is a 1 by 10 array. Accordingly, for each riboswitch sequence in each family, an observation is generated based on detected sequential blocks. In other word, each sequence is demonstrated by an observation. Therefore, the overall number of observations equals to the total number of the 7 riboswitch families’ members and the length of each array is equal to the number of total blocks for 7 families. The observations are then utilized for classification of the sequences into their associated families.

Cross-validation

To validate the generalization of the classifiers, V-fold cross-validation (VFCV) was used. 35 VFCV, due to its mild computational cost, is the most popular CV procedure. For a dataset with N members, VFCV partitions the data randomly into V subsets with approximately equal cardinality of N/V. Each subset successively plays the role of test data while the rest of the data is used to train the classifier. The overall correct classification rate (CCR) is average of the CCRs of the V stages. Here, V=10 was used for cross-validation because of the good error estimation in addition to suitably low computational cost.31,54-56

The classifiers

Four classifiers were employed to study the performance of the proposed feature extraction method.

Linear discriminant analysis (LDA) classifier: This method finds a linear combination of features to characterize or discriminate two or more classes and uses the resulting combination as a linear classifier. The LDA method is a generalization of Fisher’s linear discriminant. 31

Probabilistic neural network (PNN) classifier: The PNN algorithm estimates the class probability of an input data using the probability distribution function of each class. Then Bayes’ rule is employed to assign the input data to the class with highest posterior probability. 32

Decision tree classifier: Decision tree method creates a predictive tree-like model using a series of carefully created questions. Based on the tree as the model, it goes from observations about an input data, represented by the branches of the tree, to decisions about the input data’s class label, represented by the leaves. 33

K-nearest neighbors (KNN) classifier: In KNN classification, an input data is classified to the class most common among its K nearest neighbors. K is a positive integer number, usually small. 34 In this study, the optimum K was equaled to 4.

Evaluation of classifiers’ performance

Four performance measures of accuracy, sensitivity, specificity and f-score are calculated according to the confusion matrices using the equations (1) to (4) 57-59 :

(1)
Accuracy=TP+TNTP+FP+TN+FN

 

(2)
Sensitivity=TPTP+FN

 

(3)
Specificity=TNFP+TN

 

(4)
F-score=2TP2TP+FP+FN

 

TP denotes the true positive rate; i.e. the members of each class which are correctly classified to the right class. FP is the false positive rate; i.e. the sequences which are falsely annotated to another class. Also, TN and FN are the true negative and the false negative rates, respectively.


Results and Discussion

Detection of family specific blocks

Frequently appearing RNA sequential blocks for seven riboswitch families were detected using SBF method. 30 Results of the block finder algorithm for 7 families are presented in Table 2.


Table 2. Results of the application of the sequential block finding (SBF) algorithm for 7 families of riboswitches
Riboswitch family name Blocks Approximate Location on the sequences
Lysine AGAGGUGC 10
AGUAA 28
Cobalamin CGGUG 18
GCA 77
AGC 92
AGA 175
GACC 180
Glycine GGAGA 13
CCGA 35
SAM-alpha GUGGU 11
AUUUG 17
GCCACGU 37
SAM-IV UCA 3
GAG 7
CAG 13
GCUGG 32
CGGCAACC 38
Cyclic-di-GMP-I GAAA 23
CGCAAAGC 35
SAH GAGGAGCG 7
UGC 16
AGGCUCGG 36

As can be seen, our algorithm detected 2 blocks for the lysine family including ‘AGAGGUGC’ and ‘AGUAA’ blocks at locations 10 and 28, respectively. For the cobalamin family, 5 blocks including ‘CGGUG’, ‘GCA’, ‘AGC’, ‘AGA’ and ‘GACC’ were recognized which are located at locations 18, 77, 92, 175 and 180, respectively. Also, 2 blocks were detected for the glycine family including ‘GGAGA’ and ‘CCGA’ recognized at locations 13 and 35, respectively. For the SAM-alpha riboswitch family, 3 blocks including ‘GUGGU’, ‘AUUUG’ and ‘GCCACGU’ were recognized at locations 11, 17 and 37, respectively. Five specific blocks were detected for SAM-IV family including ‘UCA’, ‘GAG’, ‘CAG’, ‘GCUGG’ and ‘CGGCAACC’ blocks located at 3, 7, 13, 32 and 38 locations, respectively. For cyclic-di-GMP-I family, 2 blocks of ‘GAAA’ located at 23 and ‘CGCAAAGC’ located at 35 nucleotides were identified. And finally 3 blocks were detected for SAH family including ‘GAGGAGCG’, ‘UGC’ and ‘AGGCUCGG’ located at locations 7, 16 and 36, respectively. Therefore, 22 sequential blocks were identified for 7 studied riboswitch families, in total.

Model validation

Our results for 7 riboswitch families were compared to the conserved regions observed in the alignment results from Rfam database (Figure 1). As seen, most of the detected blocks fall into the highly conserved regions (shown in red) in the studied families. For example, two 8 and 5-mer blocks, ‘AGAGGUGC’ and ‘AGUAA’, were detected for lysine family. As shown in Figure 1a, these blocks are located exactly in the highly conserved areas of the lysine riboswitch structure. Also, Figures 1b-1g demonstrate the accordance of the detected blocks for cobalamin, glycine, SAM-alpha, SAM-IV, cyclic-di-GMP-I and SAH riboswitches with the consensus segments of the families, respectively.

apb-10-97-g001
Figure 1.

Accordance of the detected family specific blocks to the conserved regions of secondary structures of studied riboswitch families (based on the Rfam database). The diagrams are related to secondary structures of: (a) lysine, (b) cobalamin, (c) glycine, (d) SAM-alpha, (e) SAM-IV, (f) cyclic-di-GMP-I and (g) SAH riboswitches.


Classification results

Using sequential based block finding algorithm, SBF, 22 RNA sequential blocks [AGAGGUGC, AGUAA, CGGUG, GCA, AGC, AGA, GACC, GGAGA, CCGA, GUGGU, AUUUG, GCCACGU, UCA, GAG, CAG, GCUGG, CGGCAACC, GAAA, CGCAAAGC, GAGGAGCG, UGC, AGGCUCGG] were detected and determined as family specific blocks for 7 families. Having detected the specific blocks, observations were created using BLBFE method for classification of the riboswitches. Locations of these blocks on the family members are considered as features. The resulted 1 by 22 arrays are observations, each representing one of the riboswitches for designed classifier. As there are 808 members in total in 7 studied riboswitch families, 808 arrays of 1 by 22 as observations were produced. Of 808 created observations, 47, 430, 44, 40, 40, 155 and 52 ones belong to lysine, Cobalamin, Glycine, SAM-alpha, SAM-IV, Cyclic-di-GMP-I and SAH families, respectively. For each set of observations, LDA, PNN, decision tree and KNN classifiers accompanied by 10-fold cross-validation were applied. Then, correct and incorrect classified samples for each set were counted.

Figure 2 shows the correct classification rates (CCRs) of the studied classifiers. With the BLBFE method, PNN with 92.31% had the highest CCR while the other classifiers showed CCRs of 89.37% for decision tree classifier, 88.86% for KNN classifier and finally 80.94% for LDA classifier. Overall, the average CCR of four classifiers when using locations of specific sequential blocks as features was 87.87%.

apb-10-97-g002
Figure 2.

Correct classification rates for 4 classifiers using block location-based feature extraction method (BLBFE).


Evaluation results

Table 3 represents the multiclass confusion matrix for LDA classifier with the BLBFE. Also, the multiclass confusion matrices for PNN, decision tree and KNN classifiers with the same method of feature extraction are represented in Tables 4 to 6, respectively. Based on the confusion matrices, accuracy, sensitivity, specificity and f-score measures for the BLBFE method were calculated and illustrated in Figure 3.


Table 3. Multiclass confusion matrix for the LDA classifier, based on the features extracted by the block location-based feature extraction (BLBFE) method
Predicted/True Riboswitch Families Lysine Cobalamin Glycine SAM-alpha SAM-IV Cyclic-di-GMP-I SAH
Lysine 33 1 10 3 0 0 0
Cobalamin 13 363 46 3 1 1 3
Glycine 0 0 44 0 0 0 0
SAM-alpha 0 0 4 36 0 0 0
SAM-IV 0 0 4 0 36 0 0
Cyclic-di-GMP-I 0 0 52 0 0 103 0
SAH 0 0 12 0 1 0 39
TP 33 363 44 36 36 103 39
FP 13 1 128 6 2 1 3
TN 621 291 610 618 618 551 615
FN 14 67 0 4 4 52 13

Table 4. Multiclass confusion matrix for the PNN classifier, based on the features extracted by the block location-based feature extraction (BLBFE) method
Predicted/True Riboswitch Families Lysine Cobalamin Glycine SAM-alpha SAM-IV Cyclic-di-GMP-I SAH
Lysine 39 1 4 0 0 1 2
Cobalamin 6 407 7 3 1 5 1
Glycine 1 1 39 0 0 3 0
SAM-alpha 0 1 1 35 1 2 0
SAM-IV 0 1 0 1 37 1 0
Cyclic-di-GMP-I 1 2 7 2 0 141 2
SAH 0 0 2 0 0 2 48
TP 39 407 39 35 37 141 48
FP 8 6 21 6 2 14 53
TN 707 339 707 711 709 605 698
FN 8 23 5 5 3 14 52

Table 5. Multiclass confusion matrix for the decision tree classifier, based on the features extracted by the block location-based feature extraction (BLBFE) method
Predicted/True Riboswitch Families Lysine Cobalamin Glycine SAM-alpha SAM-IV Cyclic-di-GMP-I SAH
Lysine 40 4 1 0 0 1 1
Cobalamin 11 402 8 1 7 1 0
Glycine 1 6 31 1 0 5 0
SAM-alpha 0 4 0 30 4 2 0
SAM-IV 1 0 1 1 34 3 0
Cyclic-di-GMP-I 1 7 2 1 11 131 2
SAH 1 1 0 1 5 3 41
TP 40 402 31 30 34 131 41
FP 15 22 12 5 27 15 44
TN 669 307 678 679 675 578 668
FN 7 28 13 10 6 24 52

Table 6. Multiclass confusion matrix for the KNN classifier, based on the features extracted by the block location-based feature extraction (BLBFE) method
Predicted/True Riboswitch Families Lysine Cobalamin Glycine SAM-alpha SAM-IV Cyclic-di-GMP-I SAH
Lysine 39 3 2 0 0 2 1
Cobalamin 4 406 9 1 0 7 3
Glycine 0 14 28 0 0 2 0
SAM-alpha 0 5 1 32 0 1 1
SAM-IV 1 5 0 0 33 0 1
Cyclic-di-GMP-I 2 9 2 1 0 139 2
SAH 1 2 5 0 0 3 41
TP 39 406 28 32 33 139 41
FP 8 38 19 2 0 15 49
TN 679 312 690 686 685 579 677
FN 8 24 16 8 7 16 52
apb-10-97-g003
Figure 3.

The performance measures for classification of 7 riboswitch families by LDA, PNN, decision tree and KNN classifiers using block location-based feature extraction method (BLBFE), (a) accuracy, (b) sensitivity, (c) specificity and (d) f-score.


As seen in Figure 3a, classification accuracy measures for LDA classifier is ranged between 99.09% for SAM-IV and 83.63% for glycine families. For PNN classifier, SAM-IV family again displays the highest accuracy of 99.33% while the lowest accuracy is 87.66% for SAH family. Decision tree classifier has maximum accuracy of 97.93% for SAM-alpha family and minimum accuracy of 88.07% for SAH family. At last, the highest accuracy for KNN classifier is 99.03% which belongs to SAM-IV family, and the lowest accuracy is 87.67% for SAH family.

Figure 3b shows individual sensitivities of 4 classifications. The LDA classifier resulted in sensitivity of 100% for glycine family while the lowest sensitivity is 66.45% for cyclic-di-GMP-I family. For PNN classifier, sensitivities are ranged between 94.65% for cobalamin and 48% for SAH families. The highest sensitivity for decision tree classifier is 93.49% for cobalamin family and the lowest is 44.09% for SAH family. Finally, KNN classifier results in sensitivities from 94.42% for cobalamin to 44.09% for SAH families.

The specificities of 4 classifiers are demonstrated in Figure 3c. As demonstrated, the highest specificity for LDA classifier is 99.82% belonging to cyclic-di-GMP-I family and glycine family has the lowest specificity of 82.66%. For PNN classifier, specificities range from 99.72% for SAM-IV to 92.94% for SAH families. SAM-alpha has the highest of 99.27% with decision tree classifier while cobalamin has the lowest specificity of 93.31%. For KNN classifier, the highest specificity, 100% belongs to SAM-IV family and the lowest is 89.14% belonging to cobalamin family.

Finally, Figure 3d presents the f-scores of 4 classifiers. For LDA classifier, f-scores range from 92.31% for SAM-IV to 40.74% for glycine families. The highest f-score with PNN classifier is 96.56% belonging to cobalamin family while the lowest f-score is 47.76% for SAH family. Application of decision tree classifier results in f-scores from 94.15% for cobalamin family to 46.07% for SAH. The KNN classifier also gives maximum f-score of 92.91% for cobalamin family in addition to minimum f-score of 44.81% for SAH family.

Figure 4 shows the average performance measures of 7 riboswitch families for the BLBFE method applied in 4 classifiers. As can be seen, PNN classifier has the best average accuracy, equal to 96.1%. This is while, other classifiers also represent good average accuracies of 95.2% for KNN classifier, 94.79% for decision tree classifier and 93.98% for LDA classifier. PNN classifier has the highest average sensitivity too. 83.61%, 82.3%, 76.81% and 76.76% are average sensitivities of PNN, LDA, decision tree and KNN classifiers, respectively.

apb-10-97-g004
Figure 4.

The average performance measures of 7 riboswitch families for the proposed method of BLBFE applied in 4 classifiers.


The highest average specificity, 97.69%, belongs to the PNN classifier, followed by 96.9%, 96.58% and 96.53% for LDA, decision tree and KNN classifiers, respectively. Finally, PNN classifier again has the best average f-score, 81.91%. Other classifiers display average f-scores of 78.44% for KNN classifier, 77.97% for LDA classifier and 74.9% for decision tree classifier.


Conclusion

The importance of riboswitches’ role in gene expression regulation and their interaction with antibiotics, have attracted more interest for development of new bioinformatics tools for recognition and characterization of riboswitches. Following development of SBF algorithm for detection of frequently appearing family specific sequential blocks in riboswitch families, in this paper we first elucidated the performance of the designed algorithm in detection of the family related blocks in lysine, cobalamin, glycine, SAM-alpha, SAM-IV, cyclic-di-GMP-I and SAH riboswitches. Results showed that the developed method detected most of the conserved motifs present in each family defined as family specific blocks. Then, the identified blocks on riboswitch sequences were used for classification of the members into their corresponding families. For this, we proposed a new feature extraction strategy called BLBFE, which employs the locations of the specified blocks on riboswitch sequences as features. Therefore, each riboswitch sequence is converted into a numerical array called an observation. In order to validate the performance of the proposed feature extraction method, 4 popular classifiers including LDA, PNN, decision tree and KNN were applied and their functions in classification of the riboswitches were evaluated and compared. Putting together the results, the BLBFE strategy led to suitable performance in classification of the riboswitches with average CCR of 87.87%. Having applied BLBFE, all the studied classifiers displayed closely suitable performances, where PNN classifier performed the best according to its higher accuracy, sensitivity, specificity and f-score. Considering the proposed BLBFE method’s performance, it is concluded that the developed methods of SBF and BLBFE are promising strategies for classification of the riboswitches. More reports from our group in development and application of the BLBFE method for other groups of RNAs, DNAs and genes are in progress.


Ethical Issues

Not applicable.


Conflict of Interest

Authors declare no conflict of interest in this study.


References

  1. Winkler W, Nahvi A, Breaker RR. Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature 2002; 419(6910):952-6. doi: 10.1038/nature01145 [Crossref] [ Google Scholar]
  2. Winkler WC, Nahvi A, Roth A, Collins JA, Breaker RR. Control of gene expression by a natural metabolite-responsive ribozyme. Nature 2004; 428(6980):281-6. doi: 10.1038/nature02362 [Crossref] [ Google Scholar]
  3. Mandal M, Breaker RR. Gene regulation by riboswitches. Nat Rev Mol Cell Biol 2004; 5(6):451-63. doi: 10.1038/nrm1403 [Crossref] [ Google Scholar]
  4. Winkler WC, Nahvi A, Sudarsan N, Barrick JE, Breaker RR. An mRNA structure that controls gene expression by binding S-adenosylmethionine. Nat Struct Biol 2003; 10(9):701-7. doi: 10.1038/nsb967 [Crossref] [ Google Scholar]
  5. Robinson CJ, Vincent HA, Wu MC, Lowe PT, Dunstan MS, Leys D. Modular riboswitch toolsets for synthetic genetic control in diverse bacterial species. J Am Chem Soc 2014; 136(30):10615-24. doi: 10.1021/ja502873j [Crossref] [ Google Scholar]
  6. Peselis A, Serganov A. Themes and variations in riboswitch structure and function. Biochim Biophys Acta 2014; 1839(10):908-18. doi: 10.1016/j.bbagrm.2014.02.012 [Crossref] [ Google Scholar]
  7. Barrick JE, Breaker RR. The distributions, mechanisms, and structures of metabolite-binding riboswitches. Genome Biol 2007; 8(11):R239. doi: 10.1186/gb-2007-8-11-r239 [Crossref] [ Google Scholar]
  8. Chen J, Gottesman S. RNA Riboswitch regulates RNA. Science 2014; 345(6199):876-7. doi: 10.1126/science.1258494 [Crossref] [ Google Scholar]
  9. Havill JT, Bhatiya C, Johnson SM, Sheets JD, Thompson JS. A new approach for detecting riboswitches in DNA sequences. Bioinformatics 2014; 30(21):3012-9. doi: 10.1093/bioinformatics/btu479 [Crossref] [ Google Scholar]
  10. Roth A, Winkler WC, Regulski EE, Lee BW, Lim J, Jona I. A riboswitch selective for the queuosine precursor preQ1 contains an unusually small aptamer domain. Nat Struct Mol Biol 2007; 14(4):308-17. doi: 10.1038/nsmb1224 [Crossref] [ Google Scholar]
  11. Kang M, Peterson R, Feigon J. Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of tRNA. Mol Cell 2009; 33(6):784-90. doi: 10.1016/j.molcel.2009.02.019 [Crossref] [ Google Scholar]
  12. Blount KF, Breaker RR. Riboswitches as antibacterial drug targets. Nat Biotechnol 2006; 24(12):1558-64. doi: 10.1038/nbt1268 [Crossref] [ Google Scholar]
  13. Sudarsan N, Cohen-Chalamish S, Nakamura S, Emilsson GM, Breaker RR. Thiamine pyrophosphate riboswitches are targets for the antimicrobial compound pyrithiamine. Chem Biol 2005; 12(12):1325-35. doi: 10.1016/j.chembiol.2005.10.007 [Crossref] [ Google Scholar]
  14. Blount KF, Wang JX, Lim J, Sudarsan N, Breaker RR. Antibacterial lysine analogs that target lysine riboswitches. Nat Chem Biol 2007; 3(1):44-9. doi: 10.1038/nchembio842 [Crossref] [ Google Scholar]
  15. Serganov A, Huang L, Patel DJ. Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature 2009; 458(7235):233-7. doi: 10.1038/nature07642 [Crossref] [ Google Scholar]
  16. Ott E, Stolz J, Lehmann M, Mack M. The RFN riboswitch of Bacillus subtilis is a target for the antibiotic roseoflavin produced by Streptomyces davawensis. RNA Biol 2009; 6(3):276-80. doi: 10.4161/rna.6.3.8342 [Crossref] [ Google Scholar]
  17. Lee ER, Blount KF, Breaker RR. Roseoflavin is a natural antibacterial compound that binds to FMN riboswitches and regulates gene expression. RNA Biol 2009; 6(2):187-94. doi: 10.4161/rna.6.2.7727 [Crossref] [ Google Scholar]
  18. Mehdizadeh Aghdam E, Barzegar A, Hejazi MS. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction. Adv Pharm Bull 2014; 4(3):225-35. doi: 10.5681/apb.2014.033 [Crossref] [ Google Scholar]
  19. Mehdizadeh Aghdam E, Hejazi ME, Hejazi MS, Barzegar A. Riboswitches as Potential Targets for Aminoglycosides Compared with rRNA Molecules: In Silico Study. J Microb Biochem Technol 2014; S9:1-9. doi: 10.4172/1948-5948.S9-002 [Crossref] [ Google Scholar]
  20. Baird NJ, Inglese J, Ferre-D’Amare AR. Rapid RNA-ligand interaction analysis through high-information content conformational and stability landscapes. Nat Commun 2015; 6:8898. doi: 10.1038/ncomms9898 [Crossref] [ Google Scholar]
  21. Yoon BJ, Vaidyanathan PP. Structural alignment of RNAs using profile-csHMMs and its application to RNA homology search: overview and new results. IEEE Trans Automat Contr 2008; 53(Specia):10-25. doi: 10.1109/TAC.2007.911322 [Crossref] [ Google Scholar]
  22. Krogh A, Mian IS, Haussler D. A hidden Markov model that finds genes in E coli DNA. Nucleic Acids Res 1994; 22(22):4768-78. doi: 10.1093/nar/22.22.4768 [Crossref] [ Google Scholar]
  23. Salzberg SL, Delcher AL, Kasif S, White O. Microbial gene identification using interpolated Markov models. Nucleic Acids Res 1998; 26(2):544-8. doi: 10.1093/nar/26.2.544 [Crossref] [ Google Scholar]
  24. Yoon BJ, Vaidynathan PP. HMM with auxiliary memory: a new tool for modeling RNA structures. Conference Record of the Thirty-Eighth Asilomar Conference on Signals, Systems and Computers, 2004. IEEE; 2004. doi: 10.1109/ACSSC.2004.1399438.
  25. Singh P, Bandyopadhyay P, Bhattacharya S, Krishnamachari A, Sengupta S. Riboswitch detection using profile hidden Markov models. BMC Bioinformatics 2009; 10:325. doi: 10.1186/1471-2105-10-325 [Crossref] [ Google Scholar]
  26. Eddy SR, Durbin R. RNA sequence analysis using covariance models. Nucleic Acids Res 1994; 22(11):2079-88. doi: 10.1093/nar/22.11.2079 [Crossref] [ Google Scholar]
  27. Singh S, Singh R. Application of supervised machine learning algorithms for the classification of regulatory RNA riboswitches. Brief Funct Genomics 2017; 16(2):99-105. doi: 10.1093/bfgp/elw005 [Crossref] [ Google Scholar]
  28. Liu B, Liu F, Wang X, Chen J, Fang L, Chou KC. Pse-in-One: a web server for generating various modes of pseudo components of DNA, RNA, and protein sequences. Nucleic Acids Res 2015; 43(W1):W65-71. doi: 10.1093/nar/gkv458 [Crossref] [ Google Scholar]
  29. Liu B, Wu H, Chou KC. Pse-in-One 20: an improved package of web servers for generating various modes of pseudo components of DNA, RNA, and protein sequences. Nat Sci 2017; 9(4):67-91. doi: 10.4236/ns.2017.94007 [Crossref] [ Google Scholar]
  30. Golabi F, Shamsi M, Sedaaghi MH, Barzegar A, Hejazi MS. Development of a new sequential block finding strategy for detection of conserved sequences in riboswitches. Bioimpacts 2018; 8(1):13-22. doi: 10.15171/bi.2018.03 [Crossref] [ Google Scholar]
  31. Hastie T, Tibshirani R, Friedman J. The elements of statistical learning: data mining, inference, and prediction. 2nd ed. Springer; 2009.
  32. Specht DF. Probabilistic neural networks. Neural Netw 1990; 3(1):109-18. doi: 10.1016/0893-6080(90)90049-Q [Crossref] [ Google Scholar]
  33. Quinlan JR. C4.5: Programs for machine learning. Elsevier; 2014.
  34. van der Heijden F, Duin RPW, de Ridder D, Tax DMJ. Classification, parameter estimation and state estimation: an engineering approach using MATLAB. John Wiley & Sons, Ltd; 2004. p. 13-44.
  35. Arlot S, Celisse A. A survey of cross-validation procedures for model selection. Stat Surv 2010; 4:40-79. doi: 10.1214/09-SS054 [Crossref] [ Google Scholar]
  36. Sudarsan N, Wickiser JK, Nakamura S, Ebert MS, Breaker RR. An mRNA structure in bacteria that controls gene expression by binding lysine. Genes Dev 2003; 17(21):2688-97. doi: 10.1101/gad.1140003 [Crossref] [ Google Scholar]
  37. Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS. Regulation of lysine biosynthesis and transport genes in bacteria: yet another RNA riboswitch?. Nucleic Acids Res 2003; 31(23):6748-57. doi: 10.1093/nar/gkg900 [Crossref] [ Google Scholar]
  38. Nahvi A, Sudarsan N, Ebert MS, Zou X, Brown KL, Breaker RR. Genetic control by a metabolite binding mRNA. Chem Biol 2002; 9(9):1043. doi: 10.1016/s1074-5521(02)00224-7 [Crossref] [ Google Scholar]
  39. Serganov A, Huang L, Patel DJ. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008; 455(7217):1263-7. doi: 10.1038/nature07326 [Crossref] [ Google Scholar]
  40. Weinberg Z, Wang JX, Bogue J, Yang J, Corbino K, Moy RH. Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes. Genome Biol 2010; 11(3):R31. doi: 10.1186/gb-2010-11-3-r31 [Crossref] [ Google Scholar]
  41. Mandal M, Lee M, Barrick JE, Weinberg Z, Emilsson GM, Ruzzo WL. A glycine-dependent riboswitch that uses cooperative binding to control gene expression. Science 2004; 306(5694):275-9. doi: 10.1126/science.1100829 [Crossref] [ Google Scholar]
  42. Kwon M, Strobel SA. Chemical basis of glycine riboswitch cooperativity. RNA 2008; 14(1):25-34. doi: 10.1261/rna.771608 [Crossref] [ Google Scholar]
  43. Sherman EM, Esquiaqui J, Elsayed G, Ye JD. An energetically beneficial leader-linker interaction abolishes ligand-binding cooperativity in glycine riboswitches. RNA 2012; 18(3):496-507. doi: 10.1261/rna.031286.111 [Crossref] [ Google Scholar]
  44. Poiata E, Meyer MM, Ames TD, Breaker RR. A variant riboswitch aptamer class for S-adenosylmethionine common in marine bacteria. RNA 2009; 15(11):2046-56. doi: 10.1261/rna.1824209 [Crossref] [ Google Scholar]
  45. Corbino KA, Barrick JE, Lim J, Welz R, Tucker BJ, Puskarz I. Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria. Genome Biol 2005; 6(8):R70. doi: 10.1186/gb-2005-6-8-r70 [Crossref] [ Google Scholar]
  46. Weinberg Z, Barrick JE, Yao Z, Roth A, Kim JN, Gore J. Identification of 22 candidate structured RNAs in bacteria using the CMfinder comparative genomics pipeline. Nucleic Acids Res 2007; 35(14):4809-19. doi: 10.1093/nar/gkm487 [Crossref] [ Google Scholar]
  47. Weinberg Z, Regulski EE, Hammond MC, Barrick JE, Yao Z, Ruzzo WL. The aptamer core of SAM-IV riboswitches mimics the ligand-binding site of SAM-I riboswitches. RNA 2008; 14(5):822-8. doi: 10.1261/rna.988608 [Crossref] [ Google Scholar]
  48. Sudarsan N, Lee ER, Weinberg Z, Moy RH, Kim JN, Link KH. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 2008; 321(5887):411-3. doi: 10.1126/science.1159519 [Crossref] [ Google Scholar]
  49. Smith KD, Lipchock SV, Ames TD, Wang J, Breaker RR, Strobel SA. Structural basis of ligand binding by a c-di-GMP riboswitch. Nat Struct Mol Biol 2009; 16(12):1218-23. doi: 10.1038/nsmb.1702 [Crossref] [ Google Scholar]
  50. Wang JX, Lee ER, Morales DR, Lim J, Breaker RR. Riboswitches that sense S-adenosylhomocysteine and activate genes involved in coenzyme recycling. Mol Cell 2008; 29(6):691-702. doi: 10.1016/j.molcel.2008.01.012 [Crossref] [ Google Scholar]
  51. Edwards AL, Reyes FE, Heroux A, Batey RT. Structural basis for recognition of S-adenosylhomocysteine by riboswitches. RNA 2010; 16(11):2144-55. doi: 10.1261/rna.2341610 [Crossref] [ Google Scholar]
  52. Griffiths-Jones S, Moxon S, Marshall M, Khanna A, Eddy SR, Bateman A. Rfam: annotating non-coding RNAs in complete genomes. Nucleic Acids Res 2005; 33(Database issue):D121-4. doi: 10.1093/nar/gki081 [Crossref] [ Google Scholar]
  53. Kalvari I, Argasinska J, Quinones-Olvera N, Nawrocki EP, Rivas E, Eddy SR. Rfam 130: shifting to a genome-centric resource for non-coding RNA families. Nucleic Acids Res 2018; 46(D1):D335-D42. doi: 10.1093/nar/gkx1038 [Crossref] [ Google Scholar]
  54. Breiman L, Spector P. Submodel selection and evaluation in regression The X-random case. Int Stat Rev 1992; 60(3):291-319. doi: 10.2307/1403680 [Crossref] [ Google Scholar]
  55. Kohavi R. A study of cross-validation and bootstrap for accuracy estimation and model selection. Proceedings of the 14th International Joint Conference on Artificial Intelligence - Volume 2. Montreal, Quebec, Canada. Morgan Kaufmann Publishers Inc; 1995. p. 1137-43.
  56. Braga-Neto UM, Dougherty ER. Is cross-validation valid for small-sample microarray classification?. Bioinformatics 2004; 20(3):374-80. doi: 10.1093/bioinformatics/btg419 [Crossref] [ Google Scholar]
  57. Fawcett T. An introduction to ROC analysis. Pattern Recognit Lett 2006; 27(8):861-74. doi: 10.1016/j.patrec.2005.10.010 [Crossref] [ Google Scholar]
  58. Sun Y, Kamel MS, Wong AKC, Wang Y. Cost-sensitive boosting for classification of imbalanced data. Pattern Recognit 2007; 40(12):3358-78. doi: 10.1016/j.patcog.2007.04.009 [Crossref] [ Google Scholar]
  59. Sokolova M, Lapalme G. A systematic analysis of performance measures for classification tasks. Inf Process Manag 2009; 45(4):427-37. doi: 10.1016/j.ipm.2009.03.002 [Crossref] [ Google Scholar]